Saturday, April 25, 2015

reception exploration berkowitz




"Keep busy while you're waiting for something to happen,"  Robert Genn


My niece is here for the weekend, taking a break from college for a few home cooked meals, so we went to the turtle hospital yesterday.  I love this facility-  any time there is an injured or sick sea turtle someone finds, they take them in and care for them until they can be released back into the ocean. They have an 'adoption' procedure so you can have a turtle to follow when they are released-  always a big ceremony when they take a guy back to the ocean.  We adopted two a few years ago, one had a racking device attached and was back in Cape Cod Bay in just a few days-  of course he got a tail wind from the Gulf Stream, but still made amazing time.  So much fun to watch their progress. Anyway, Izzy enjoyed it as much as I do.  
Today I think we will go to the Busch rehab center where they rescue animals that are hurt or unable to return to their habitat.  They have six bald eagles in one cage-  amazing to see!  Some were hit by cars, some were shot at, some just got involved in something they shouldn't have.  Now you know where my 'extra' money goes.

I spent yesterday extricating myself from one mess after another-  First I am storing stuff in the studio and I went to drop off a load but accidentally hit a bag from it's precarious perch and it crashed to the ground.  There went the fabulous ceramic lanterns I had found a while back for the outdoor area in the new place.  A thousand pieces,  luckily confined to the original bag so it was an easy rip to the dumpster.  Next I found the wallpaper I've been hoarding so I could match some paint for the rest of the room, took it to the Ben Moore place and found paint colors for two or three other rooms too.  When I got home the wallpaper was missing so I had to retrace my route.

Also lost my keys and spent way too long finding them.  Then lost MYSELF trying to show Izzy the ocean.  Right.  What a neurologic aberration.  I'm surprised I can use sharp tools.

Art for the day theme is stuff looking like other stuff, something I have always loved.  




Carved from a single block of wood, Chris Hedrick crafts everyday items and objects and making them appear soft, limp, stretched and fluid.  His sculptures of tools, clothing, toys and guns are carved at original scale to trick the viewer into thinking they are seeing the natural object as opposed to a carved wood representation of it. Several of his pieces even appear to have textures such as terry cloth, canvas and suede.





California-based glass artists Marsha Blaker and Paul DeSomma collaborate to make vases that capture the power and intensity of something you wouldn’t expect a vase can even hold: the ocean. By trapping bubbles within the hot glass and adding layers of white foam detail, the duo creates realistic sculptures reflective of the beauty of a crashing wave. Each one will have you do a double take with their perfectly constructed depth, movement, and texture. It’s as if they took actual waves and froze them into vases!
See more of the husband-and-wife team’s captivating sculptures here, or you can give their gallery a visit over at Kela’s in Kapaa, Hawaii.


Today's squirrel is part of an old quilt-  I love how he fills the corner with his bushy tail, and thanks self preservation I didn't get tasked with that appliquĂ©!  Sorry I don't know more about this quilts.

I guess that's it for today, hoping to get back on track with posting.  I'd love to hear from you if you're still with me.  Today I am headed over to the house to grab some more pictures-  the guys have been working hard to get it going, and it is finally starting to look like a house rather than a construction site.  Well, sort of.  Yesterday the roofers were there in 85 degree heat.  I need to make a wheelbarrow full of lemonade for them.  Terrible job!

Friday, April 24, 2015

gauleiter pliny nolan



"We need to pay exquisite attention to our responses to things -- noticing what makes our flame glow brighter. If we pay attention to those things, we'll be able to catch the flame and feed it." (Nina Simons)


Panoramic ccccccaaaaaaaaatttttt


Dig notice I was missing?  Seems TY was messing with internet settings and knocked out any chance I had to even read messages unless I was out of the house.  He somehow changed passwords to something I have no idea of and didn't have time to sort it out with Comcast.  ANDou can't change a password unless you can get on the internet-  so my genius guy found outI'm back from Boston where I met some glaring sunshine-  so bright I had to wear my sunglasses inside!  A fortunate weather trip?  Not necessarily, it's mostly due to having a couple of GUYS there washing my windows!  We are putting the condo on the market and are cleaning it out, cleaning it up, and getting a few things done that it's hard to schedule not living here.  Needless to say...

Every muscle in my body was aching from packing up stuff for storage and eventually shipping off.  I've pulled out all the drawers and unbelievably found SIX bottles of heavy narcotics prescribed from operations more than 10 years ago-  I hate taking that stuff so would stick it int he way-back and didn't realize I still had any.  No, don't break in looking for my stash, I sprayed it liberally with 409 and a little water, came back in an hour ant had turned into marshmallow fluff and was easily disposable in the trash.  Sorry, already gone.  I coulda been rich.

I packed 14 boxes so far, mostly just pictures in frames, books and CDs (TY won't part with them, doesn't trust iPod technology, says 'it doesn't sound the same'.  Also doesn't like the way iTunes lists different acts of an opera-  it may be out of sequence.  Geesh.  I've pulled all the dishes out of the cupboards I want to send, some favorite hand made pottery and the antique stuff I love.  but I am out of bubble wrap and we were car sharing so much will have to wait.  To screw up our getting around to accomplish things, this was also Boston Marathon weekend, formerly Marathon Day but like so many other really cool things, blown out of the water by folks trying to make a buck.

But I'm home again and finally have internet service back so catch-up is the name of the game and unfortunately the Muse is the one knocked to the end of the list.  

Today we have a theme (I love themes) for some art I found- 
 'things made with things not meant to make them'




A whole series of Lego clutch purses!  I.....want....one....







Plants and animals made from PET bottles!  Czech artist Veronika Richterová, born in 1964, the year represented a turning point in her artistic foray when she devoted herself to creating individualistic art pieces with the easily accessible PET bottles.  In Veronika’s hands, the easily malleable PET bottles has proven to be an excellent material for fulfilling her artistic intentions. She has been breathing new life into these recycled items for the past decade, adopting various methods of cutting, heating and assemblage to produce quirky products, from crocodiles to sofas, light fixtures to plants.

I'll be back soon as I can.  I am racing over to the house this morning to get paint swatches sorted out-  the ceilings are done and now I have to pick colors for the coffered parts and the walls.  The red laundry looked good, but I'm changing the living room from white to something a bit softer...and Agreeable!  (It's called Agreeable Gray!)  Also today we are picking up my niece at the airport as she is understandably taking a break this weekend from college dining.  It will be fun to have her around!

Hope she likes squirrels.



Wednesday, April 15, 2015

entity calvinist sally

'interesting???'  I don't think so.  Try despicable.


"Art lives from constraints and dies from freedom." (Leonardo Da Vinci)


I was able to get some dingle balls glued to the lampshades yesterday but for the most part I was trying to get my scanner and one of my printers to communicate with my aging balky computer.  Ya see, I have to re-license my dog and if I have PROOF OF AGE they knock a few bucks off.  So, since I haven't been asked for any proof in 50 years, I don't have much to send except my drivers license, thus the scan.  Took me about 5 tries and if you ever need a FL drivers license that is 8.5x11", ask me to do it for you.  Sigh.

Next was trying to fill out a Call of Entry for a local show coming up here but everything I tried to do was impossible, the questions were impossible, the payment was impossible and on and on.  I made copie=s fall the info and will take it with me back to Boston where I will try to figure out the next step.  I've never had problems entering any of the regular shows we enter but this one is convoluted-  it's a mixed media show put on by a local Art Center-  would take me 5 minutes to drive to it and give them a CD or hard copies, or cash!  Geesh.

Next I needed to print boarding passes because for some reason I can't get this boarding pass onto my phone App like I have before.  Tried and tried to no avail so printed out the passes and am ready to go.  Old school.  But to prove I am 'worthy' I will buy my coffee at Starbucks with that App.  Yes I can.  Yes I can.  



This is a SERIOUS bag-  I found it on a consignment website but simply cannot imagine carrying it around any more than carrying a real boombox or pushing a wheelbarrow.  I think it gets it's own seatbelt in your car.  Plunges beyond ironic right into stoopidity.  Yes, even with my shoes-and-bags problem this doesn't interest me other than the OMG factor.
Now, if you're looking for a present for me that I will never use, but keep in a glass cabinet, gimme this one-  sort of a ridiculous-to-sublime thing here.
About 5" across and about $5000.  This picture is as close as I'll ever get.  


New artist to me, and I'm in love!  Here are two different parts to his art, first IN a gallery, second, OUTSIDE.



Belgium-based ROA on the occasion of his solo in New York.  See the results of his hard work over the last month crafting and painting a new body of work entitled Metazoa. The show at Jonathan LeVine Gallery’s  529 West 20th Street location featured the prolific street artist’s familiar animal imagery painted on found objects with clever interactive panels or different point of views that highlight different anatomic systems in each of his subjects. 

Just before the NY show, ROA debuted at POW! WOW! Hawaii 2015 with a double piece painted just outside of Lana Lane studios. Familiar with using architectural elements and obstacles wisely in his work, he made a great use of the corner wall he was painting on.  The creatures of choice for this mural was the nautilus and hermit crab, both native species of the Hawaiian islands.  The final image features the two shellfish embracing each other in what can be seen as a hug or a fight. Using rollers and spray cans, ROA left a very recognizable mark with this piece in the Kaka’ako district. 





And in my scrolling around I found another squirrel product here: 
Yes, you can buy it, but I can't remember where-  google it if you're nuts about it and don't have a peanut allergy.

Got a plane to catch and work to do.  See you all next time I can sign on, wherever that may be.


Monday, April 13, 2015

captivate dietary gap

XL today because it's a poster and a quote all rolled into one. Thank you Buddha.



My life lately can be summed up with this-
Oh lordy, how boring!  Too beige, too gray, too warm, too cold, too light, too dark.





I have to admit I got very little done over the days I was on my own here.  I dropped stuff off at the studio, looked around and got depressed over the mess, and picked up a few things for the dumpster.  I did manage to work on a collage I've been thinking about for a couple of weeks now-  I was flipping through a Sunday magazine and was appalled at how angry all the men were modeling clothes- page after page of scowling guys, so I cut them out and kept them flying around my worktable every time the AC went on.  I added to the pile, edited some guys out, and fussed and fiddled with them.  This is the so-far mock-up.  I plan on some horizontals.  Maybe today.  And then I have to get them all stuck down rather than temporarily tacked.  So, ladies, don't let your sons grow up to be models-  they are a very unhappy bunch.

The other thing I noted was that a huge percentage of them have the top of their scowling heads lopped off, seems to be a prevailing fashion-photographic style but when it happens in 50% of the pictures it becomes as boring as batik fabrics.  And they don't wear socks even with suits that cost in the thousands.  Working title, 'Angry Men of the Cloth'.  They WILL appear in a more complete form soon.  That's D&G there on the bottom.  


Speakin' of Phashion, here comes a Sandy Editorial:  The other day I saw a picture of a 'celebrity' famous for nothing and she was wearing a $800 hoody sweatshirt with expertly ripped jeans and inexplicably high stilettos with (ahem) red soles, so we will 'know' how much she spent on those to hobble down the broken sidewalk with the papaparazzi in tow.   (Well, it was $700+ but the retail didn't include the tax) It was juxtaposed next to her celebrity husband at another photo-op wearing his own version of the sweatshirt for another almost $800.  This is something I just don't get-  If you want to look 'street', then shop where the street people shop!  What in the world makes a ripped up sweatshirt worth that money? 
 I can get the same hoody at Macy's for Orig. $29.50, Now $13.99, EXTRA 20% OFF online!  I just checked. 


After that major sidetrack, I will go back to the studio
 Today I will add on the pom pom balls.  The black rhinestone border that I really liked won't stick-  I tried three different glues.  Swear they have a teflon backing.  I even tried the glue gun but the glop came through the spaces between the stones and looked awful.  Sometimes it pays to just buy a new friggin' lampshade.  
Very exciting shot, no?
While at Joannes trying to buy trimming for the lampshades, I found this little guy in the dump-it basket.  (be still my heart) A squirrel tape measure/pin cushion.  He was marked down to less than a dollar so I rescued him.  Meanwhile spent a bundle on the useless black rhinestone trim.



And now the 'TAIL' of the cross dressing squirrel-  I've featured Tommy before as my SOTD (squirrel of the day) but now he has a real show and is an art piece!  These were taken on a live costumed squirrel, no taxidermy was done, though I have to say that Tommy doesn't look too thrilled.



The Nutty Squirrel That Dressed in Drag
“You can’t be friends with a squirrel — a squirrel is just a rat with a cuter outfit,” Sarah Jessica Parker once quipped. Obviously she had never encountered Tommy Tucker, a friendly gender-bending squirrel from the 1940s who took cute outfits to a whole new level.

Despite Tommy’s male anatomy, photographer Nina Leen and his owner, Zaidee Bullis, styled the squirrel in drag for a LIFE magazine feature in 1944. Prints of those photos are now on view at Daniel Cooney Fine Art in Chelsea. Although the word “unique” has been overused nearly to the point of meaninglessness, it deserves a comeback for this fusion of mid-century doll outfits, LIFE‘s quintessential photojournalistic style, and sciurid drag.

What is “sciurid”? It wouldn’t be unique if it involved a word you recognize. “Sciurid” is that niche adjective for rodents in the Sciuridae family, which includes squirrels, chipmunks, and marmots. Tommy Tucker was an orphaned squirrel in Washington, DC, when Zaidee Bullis adopted him. For some reason the squirrel inspired Bullis to sew custom-made doll dresses for him to flaunt. (There were weird people in the 1940s too, and Bullis didn’t have to deal with PETA, which didn’t exist until 1980.) Although Tommy occasionally bit his adopted mother, he otherwise went along with the shenanigans and donned the outfits. He had a free place to stay.

Nina Leen’s photographs of Tommy Tucker are on view in the exhibition Lenslady at Daniel Cooney Fine Art (508–526 W 26th Street, #9C, Chelsea, Manhattan) through May 16.


                                                                                                                                                    bye.